subject
Biology, 02.12.2020 17:10 gabrieljerron

What can a stars color indicate about its properties

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 21:00
Leila has dimples because she received a gene copy from her father that coded for dimples. this means that dimples are an example of a trait that is
Answers: 2
question
Biology, 22.06.2019 02:30
Are the earth's ocean floor and continents the same age geologically? why or why not?
Answers: 1
question
Biology, 22.06.2019 06:30
Agroup of students is studying convection currents. they fill two identical balloons with the same amount of helium. one balloon is placed in a freezer and the other in an area with warm air. after 10 minutes, the balloons are released from a height of 1 meter. which of the following do the students most likely observe? question 8 options: the cold balloon expands and rises. the warm balloon shrinks and sinks. the balloons rise at the same rate. both balloons are the same size. the ballons both rise. the cold ballon is larger than the warm balloon. the warm balloon expands and rises. the cold balloon shrinks and sinks.
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What can a stars color indicate about its properties...
Questions
question
Computers and Technology, 30.06.2019 16:40
Questions on the website: 13722363