Mike has a problem with his testosterone. He is unable to produce enough. Which will most likely be affected by his inability to produce testosterone? Select two options.
urine production
sperm production
producing fluid to help sperm move
appearance of secondary sex characteristics
egg production
egg movement to the uterus

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

During the process of blank and molecules such as a glucose must use a protein channel to cross through a cell membrane

During dna replication,each strand of dna is used as a template to produce a complementary strand of dna. this process is shown below. which base will attach to location