subject
Biology, 01.12.2020 14:10 magicalunicorns47

The process of antibody-dependent cellular cytotoxicity (ADCC) allows cells to bind to antibody-coated host cells that may have viral proteins in their plasma membrane in order to kill them, inducing apoptosis and limiting viral spread.

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 20:30
Prior to the development of dna fingerprinting, blood type could be used to determine possible parentage. although it might prove someone was not a parent, it could not show if someone was positively the parent, only that he or she might be a parent. which of the following is a true statement that can be made about parentage based on blood typing?
Answers: 2
question
Biology, 22.06.2019 10:30
What is a dendrite and what does it do?
Answers: 1
question
Biology, 22.06.2019 11:30
How dose plate tectonics effect climate
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
The process of antibody-dependent cellular cytotoxicity (ADCC) allows cells to bind to antibody-coa...
Questions
question
English, 10.09.2020 01:01
question
Mathematics, 10.09.2020 01:01
question
Mathematics, 10.09.2020 01:01
Questions on the website: 13722362