Biology, 29.11.2020 05:10 mrbear4099
Below is a sequence from a template strand of DNA. Write the sequence of the mRNA that would be transcribed from this. Be sure to label the 3’ and 5’ ends.
DNA:3’ A G G T C T T C A C 5’
mRNA:
Answers: 2
Biology, 21.06.2019 17:00
Microorganisms aren’t all decomposers; in fact, many act as producers or primary consumers in an ecosystem. how do microorganisms that act as producers benefit the rest of an ecosystem in terms of energy transfer? what about microorganisms that act as primary consumers?
Answers: 1
Biology, 22.06.2019 11:00
What are antigens and antibodies? how are they involved in the body’s response to incompatible blood?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Below is a sequence from a template strand of DNA. Write the sequence of the mRNA that would be tran...
Mathematics, 05.12.2020 01:00
Mathematics, 05.12.2020 01:00
English, 05.12.2020 01:00
English, 05.12.2020 01:00
Mathematics, 05.12.2020 01:00
Mathematics, 05.12.2020 01:00
Mathematics, 05.12.2020 01:00
English, 05.12.2020 01:00
Mathematics, 05.12.2020 01:00
Business, 05.12.2020 01:00
Mathematics, 05.12.2020 01:00
English, 05.12.2020 01:00
Social Studies, 05.12.2020 01:00
Mathematics, 05.12.2020 01:00