what aspects of gas giants is most responsible for their low temperatures a. their distance from the sun b. their gaseous composition c. their speed of rotation d. their lack of atmosphere

During a fierce storm a large number of tall trees on an island are uprooted by the wind and die. most of the trees on the island are now short trees and produce seeds that grow into short trees. what concept is shown in this example? question 5 options: natural selection artificial selection genetic engineering gene splicing

Which of the following are not included as modern mammals that evolved during the eocene epoch? primates artiodactyls perissodactyls none of the above

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?