subject
Biology, 16.11.2020 09:20 j4ckd4ws

Enzymes , last question pls help


Enzymes , last question pls help

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 18:30
When does dna replication(make a copy of itself)?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:50
Involving transcription and translaton. explain the causes and effects of damage to the genetic code.
Answers: 1
question
Biology, 22.06.2019 18:50
Which if the following best describes why invertebrates isn’t considered a scientifically valid word when classifying animals
Answers: 1
You know the right answer?
Enzymes , last question pls help
...
Questions
question
Arts, 21.10.2020 19:01
Questions on the website: 13722367