Biology, 06.11.2020 01:00 faithlopez209
Microfilaments are a component of a cell's cytoskeleton and are made of the protein actin. They are important for giving a cell its shape and also aid in .
A.
cellular movement
B.
protein synthesis
C.
DNA replication
D.
energy conversion
Answers: 3
Biology, 21.06.2019 13:30
One function of the poly-a tail on eukaryotic mrna sequences is to the mrna be transported from the nucleus to the cytoplasm. prokaryotic mrna also has a poly-a tail. choose the best explanation of the prokaryotic poly-a tail. a. prokaryotic poly-a tails have the same functions as eukaryotic poly-a tails, because this process is highly conserved throughout different species. b. prokaryotic poly-a tails aren't important, because prokaryotes don't have nuclei. c. prokaryotic poly-a tails have other functions, because prokaryotes don't have nuclei. d. prokaryotic poly-a tails are composed of a different molecular structure compared with eukaryotic poly-a tails.
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:00
Which are evidence of seafloor spreading? check all that apply. molten material magnetic stripes continent material drilled core samples ocean water samples
Answers: 1
Biology, 22.06.2019 13:00
Grade 91.)the gravitational pull from the moon words).2.) what is the rate of gravitational 3.)if you drop a hammer, is it more likely to drop handle side down, head side down, or equal chance that it will land either way? why? 4.)a car moves 60km east and 90km west.a.) what is the distance the car traveled? b.) what is the car's displacement5.)what is the average velocity of a car that moved 60 km south in 3 hours? 6.) a car starts from rest and acceleration to 60 m/s over a time of 5 seconds. what is the acceleration of the car? 7.)what is the speed of an object at rest?
Answers: 1
Microfilaments are a component of a cell's cytoskeleton and are made of the protein actin. They are...
History, 08.03.2021 14:00
Mathematics, 08.03.2021 14:00
Biology, 08.03.2021 14:00
Mathematics, 08.03.2021 14:00
Computers and Technology, 08.03.2021 14:00
Mathematics, 08.03.2021 14:00
Physics, 08.03.2021 14:00
Mathematics, 08.03.2021 14:00
Computers and Technology, 08.03.2021 14:00
Mathematics, 08.03.2021 14:00
Mathematics, 08.03.2021 14:00
Advanced Placement (AP), 08.03.2021 14:00