Biology, 30.10.2020 17:00 imstressed
Within an individual cell, where are the cytoplasm and the nucleus found? What characteristic of plant cells can be inferred from observations of the cytoplasm & nucleus?
Answers: 2
Another question on Biology
Biology, 22.06.2019 05:40
Identify characteristics of energy from the sun. check all that apply. almost all of the energy on earth comes from the sun. energy from the sun is known as mechanical energy. the energy in fossil fuels originally came from the sun. plants convert the energy of sunlight into chemical energy.
Answers: 1
Biology, 22.06.2019 06:00
In tomato plants, mendel found that the allele for smooth seeds (s) is dominant, while the allele for wrinkled seeds (s) is recessive. which of these punnett squares shows crosses between two plants heterozygous for smooth seeds? i need this to be answered as soon as ! sry the picture is bad quality
Answers: 3
Biology, 22.06.2019 08:00
Cattle with brown fur and cattle with white fur will produce a reddish roan calf . when examined closely, the calf show about an even number of brown hairs and white hairs that give a reddish appearance when viewed from far away. the fact that both the brown fur allele and the white fur allele are expressed equally in the offspring is an example of
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Within an individual cell, where are the cytoplasm and the nucleus found? What characteristic of pla...
Questions
Computers and Technology, 09.12.2019 18:31
English, 09.12.2019 18:31
