During the process of replication, a molecule of DNA unzips, forming two single strands what makes up each individual strand of DNA? A( paired adenine and uracil bases
B( Paired thymine and guanine bases
C( sugar groups attached to individual amino acids
D( nitrogenous bases attached to a sugar- phosphate backbone

Dna. we have heard that we are a product of our dna. but where is it? how do we "get" our dna? it is passed to us, from our parents, but in what form? several vocabulary words associated with inheritance are used interchangeably and sometimes, incorrectly. let's see if you can clear this up for someone just learning about inheritance and cell structure.

What are the two causes of density in deep current waters? a. salinity (how much salt) of the water and high temperaturesb. salinity (how much salt) of the water and low temperatures c. oxygen content of the water and high temperatures. d. oxygen content of the water and low temperatures

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?