How does mitosis help organisms?
a) Mitosis is the process where new identical cells are created.
b) Mitosis provides energy that organisms need to grow and live
c) Mitosis is used in the reproduction of new multicellular organisms.
d) Mitosis allows organisms to absorb water and oxygen needed to make chemical energy
Answers: 1
Biology, 21.06.2019 16:00
How are organisms in the domain eukarya different from those in the domain archaea? o a. eukaryotes have a cell wall. o b. eukaryotes have mitochondria. o c. eukaryotes have more than one cell. o d. eukaryotes have dna. submit
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
How would you expect the mrna codons that code for the amino acids that make up hemoglobin to compare between humans
Answers: 1
Biology, 22.06.2019 16:30
Which of the following is an example of competition a. the leaves of a tree prevent a small shrub from getting sunlight. three species of birds feed a different heights in the same tree. b. three species of birds feed at different heights in the same tree c. zebra and giraffe’s feed on different grassland plants d. cats living in two different homes eat the same brand of cat food.
Answers: 1
How does mitosis help organisms?
a) Mitosis is the process where new identical cells are created.
Mathematics, 07.05.2021 20:20
Mathematics, 07.05.2021 20:20
Physics, 07.05.2021 20:20
English, 07.05.2021 20:20
English, 07.05.2021 20:20
Chemistry, 07.05.2021 20:20
Mathematics, 07.05.2021 20:20
Mathematics, 07.05.2021 20:20
Mathematics, 07.05.2021 20:20
Arts, 07.05.2021 20:20
Mathematics, 07.05.2021 20:20
Mathematics, 07.05.2021 20:20