subject
Biology, 23.10.2020 03:01 breahk12

What is the role of enzymes in the DNA replication process? A. Enzymes read the DNA code and build a new DNA molecule from scratch.
B. Enzymes link together to form a template for a new DNA molecule to be built.
C. Enzymes split the DNA molecule into two rails and then transport corresponding nitrogenous bases to each rail.
D. Enzymes link adjacent nucleosides together, becoming an integral part of the structure of the new strands of DNA.

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 02:40
How are the testes and ovaries similar? a. both produce sex cells. b. both connect internal reproductive organs to the exterior. c. both transport sex cells from their site of production. d. both store mature sex cells.
Answers: 1
question
Biology, 22.06.2019 05:00
This is so important ugh its 25 points
Answers: 2
question
Biology, 22.06.2019 07:30
What evidence did mendel find that supported his law of independent assortment? a. some traits are controlled by several different genes. b. a trait can be passed on from a parent to an offspring. c. most traits have a dominant form and a recessive form. d. different traits are passed on independently of each other.
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What is the role of enzymes in the DNA replication process? A. Enzymes read the DNA code and build...
Questions
question
Mathematics, 21.12.2019 22:31
question
Mathematics, 21.12.2019 22:31
question
Mathematics, 21.12.2019 22:31
question
Mathematics, 21.12.2019 22:31
Questions on the website: 13722359