Biology, 22.10.2020 21:01 mckennacwilliams
The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and the A on both strands. How many restriction sites are
there in the following sequence? ATTOTTOMTTCOTATTGAATTCCO TACACTTAGCATAATTAAGGG
1)none
2)one
3)not enough information
4)three
5)two.
Answers: 3
Biology, 22.06.2019 00:00
Mouse liver cells were homogenized and the homogenate subjected to equilibrium density-gradient centrifugation with sucrose gradients. fractions obtained from these gradients were assayed for marker molecules (i.e., molecules that are limited to specific organelles). the results of these assays are shown in the figure. the marker molecules have the following functions: cytochrome oxidase is an enzyme involved in the process by which atp is formed in the complete aerobic degradation of glucose or fatty acids; ribosomal rna forms part of the protein-synthesizing ribosomes; catalase catalyzes decomposition of hydrogen peroxide; acid phosphatase hydrolysis monophosphoric esters at acid ph; cytidylyltransferase is involved in phospholipid biosynthesis; and amino acid permease aids in transport of amino acids across membranes. a) name the marker molecule and give the number of the fraction that is most enriched for each of the following cell components: lysosomes; peroxisomes; mitochondria; plasma membrane; rough endoplasmic reticulum; smooth endoplasmic reticulum.
Answers: 3
The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and...
Advanced Placement (AP), 26.01.2021 19:30
Biology, 26.01.2021 19:30
Chemistry, 26.01.2021 19:30
Mathematics, 26.01.2021 19:30
Mathematics, 26.01.2021 19:30
Health, 26.01.2021 19:30
Mathematics, 26.01.2021 19:30
Mathematics, 26.01.2021 19:30
Mathematics, 26.01.2021 19:30
Mathematics, 26.01.2021 19:30
Biology, 26.01.2021 19:30
Arts, 26.01.2021 19:30
Chemistry, 26.01.2021 19:30
Mathematics, 26.01.2021 19:30