Which of the following describes the zone of life on earth that includes all living things?
li...
Biology, 26.09.2019 19:00 guccim5971
Which of the following describes the zone of life on earth that includes all living things?
lithosphere
atmosphere
biosphere
magnetosphere
Answers: 2
Biology, 22.06.2019 00:00
Question 1 of 102 pointswhich best describes adaptive radiation? oa. geographical isolation caused by an adaptationob. biodiversity resulting from few ancestorsoc. a decrease in the rate of speciationd. adaptations that organisms teach each other
Answers: 2
Biology, 22.06.2019 10:40
Which of the following is the earliest era of earth's geologic time scale? cenozoic mesozoic precambrian paleozoic
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
What is the role of dna ligase in the elongation of the lagging strand during dna replication?
Answers: 1
Biology, 13.07.2019 05:50
Biology, 13.07.2019 05:50
Biology, 13.07.2019 05:50
History, 13.07.2019 05:50
History, 13.07.2019 05:50
Geography, 13.07.2019 05:50
Social Studies, 13.07.2019 05:50
History, 13.07.2019 05:50
Biology, 13.07.2019 05:50
Mathematics, 13.07.2019 05:50
History, 13.07.2019 05:50
Mathematics, 13.07.2019 05:50