subject
Biology, 21.10.2020 16:01 smariedegray

The decline in approximately 70% of the world’s bird species is particularly alarming to scientists because .

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 00:00
If the coding part of an mrna molecule is 1800 nucleotides (bases) in length, this molecule will contain codons and code for a polypeptide that is amino acids long.
Answers: 3
question
Biology, 22.06.2019 04:30
Types of scientific inquiry that biologist engage in that cannot be completely controlled
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:40
In a cladogram, what occurs at a node? a derived trait appears. evolution is stopped. an ancestor dies. the cladogram ends. aa as s as ss what are the chances that their offspring will have sickle cell anemia? 0% 25% 50% 100%
Answers: 3
You know the right answer?
The decline in approximately 70% of the world’s bird species is particularly alarming to scientists...
Questions
question
Mathematics, 10.09.2021 01:00
question
Mathematics, 10.09.2021 01:00
question
Mathematics, 10.09.2021 01:00
Questions on the website: 13722363