Biology, 19.10.2020 08:01 dflorez3064

MAY give brainliest! Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Highlighted letters are: ATACTACC

Answers: 2

Show answers

Another question on Biology

Biology, 21.06.2019 17:30

In the context of the neural impulse, which of the following is true about the depolarization of neuron membranes?

Answers: 1

Answer

Biology, 21.06.2019 18:00

Awater molecule is polar because there is an uneven distribution of these between the oxygen and hydrogen atoms.

Answers: 1

Answer

Biology, 22.06.2019 02:00

Which units ate used to measure both velocity and speed? check all that apply

Answers: 1

Answer

Biology, 22.06.2019 08:30

Approximately percent of the energy created by cell metabolism is used by the body to carry on its normal functions, such as respiration, digestion, reproduction, muscular movement, circulation, and cellular regrowth.

Answers: 3

Answer

You know the right answer?

*MAY* give brainliest! Please give answer and explain:

This sequence encodes for a part...

Questions

Business, 06.08.2019 01:10

Julian transferred 100 percent of his stock in lemon company to apricot corporation in a type b stock-for stock exchange. in exchange, he received sto...

Business, 06.08.2019 01:10

Project l costs $75,000, its expected cash inflows are $13,000 per year for 8 years, and its wacc is 10%. what is the project's mirr? do not round in...

Mathematics, 06.08.2019 01:10

Sally reynolds sells real estate along the coastal area of northern california. below are her total annual commisions between 2002 and 2012. find the...

Physics, 06.08.2019 01:10

Which set of the following contains only true statements: a. it is usually more convenient to measure δe than δh. b.“hot packs” used by...

Spanish, 06.08.2019 01:10

La inmigración fue muy importante en cuba desde la hasta mediados del siglo xx. question 8 with 1 blank buena vista social club interpreta canciones c...

Computers and Technology, 06.08.2019 01:10

You have been chosen to be a teaching assistant in your database course. the instructor asks you to prepare a presentation on big data. data is the p...

Health, 06.08.2019 01:10

An off-duty certified medical assistant a pregnant woman deliver in a movie theater restroom. to what standard of care could the medical assistant be...

Biology, 06.08.2019 01:10

Glycolysis is regulated primarily by a) the availability of glucose-6-phosphate b) three strongly exergonic, non-equilibrium reactions...

Computers and Technology, 06.08.2019 01:10

On a cost-per-thousand (cpm) basis, the cost of web ads for the most a) is much less expensive. b) does not cost anything, because ther...

Social Studies, 06.08.2019 01:10

Emma left home to attend college and lived on her own until she got married. as her own children grew up and left home, emma’s parenting responsibilit...

Social Studies, 06.08.2019 01:10

Anew customer calls a representative and says the following: "i own 1,000 shares of def stock, which is currently held at another broker-dealer. i wa...

Biology, 06.08.2019 01:10

Forensic scientists studying the human body at crime scenes need to be ready to face the criminal the jury the unpleasantness of dead and decaying fl...

Social Studies, 06.08.2019 01:10

What was the april 1961 cia-led invasion of cuba to topple fidel castro that proved to be a total failure when, of the invading force of 1,400, 1,100...

Social Studies, 06.08.2019 01:10

Asedimentary rock that shows evidence of contact metamorphism must be in age than the igneous rock with which it is in contact, even if it lies above...

Mathematics, 06.08.2019 01:10

Ajuly sales forecast projects that 6,000 units are going to be sold at a price of $10.50 per unit. the management forecasts 2% growth in sales each mo...

Physics, 06.08.2019 01:10

If the frequency of this beam is increased while the intensity is held constant, does the number of electrons ejected per second from the metal surfac...

Spanish, 06.08.2019 01:10

Complete the following sentences: (1) no encuentro mis llaves, creo que se quedaron en casa. (2) debías cuidar el pastel de cumpleaños,...

Biology, 06.08.2019 01:10

Together, the skeleton and muscles enable movement. skeletal muscles contract and on the bones to which they are attached, allowing us to respond to...

Computers and Technology, 06.08.2019 01:10

After looking up his friend's phone number, alex was able to remember it only long enough to dial it correctly. in this case, the telephone number was...

Physics, 06.08.2019 01:10

Europa, a satellite of jupiter, is believed to have a liquid ocean of water (with a possibility of life) beneath its icy surface. in planning a future...

More questions: Biology Another questions