*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a par...
![subject](/tpl/images/cats/biologiya.png)
Biology, 19.10.2020 08:01 kyandrewilliams1
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:00
Which of the following statements about archaea and bacteria is true? a. neither is single-celled. b. they both have nuclear membranes. c. neither reproduces by binary fission. d. they both lack a nuclear membrane.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:30
Which set of characteristics best describes sedimentary rock? a) largest type of rock, made of organic matter, hardest type of rock b) often contains layers, forms near sources of water, contains fossils c) least abundant type of rock, made of other rocks, made mostly of minerals d) most abundant type in earth's crust, made of magma/lava, contains no fossils
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 07.04.2021 21:40
![question](/tpl/images/cats/mat.png)
Mathematics, 07.04.2021 21:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mkx.png)
Arts, 07.04.2021 21:40
![question](/tpl/images/cats/en.png)
English, 07.04.2021 21:40
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 07.04.2021 21:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ap.png)
Advanced Placement (AP), 07.04.2021 21:40
![question](/tpl/images/cats/istoriya.png)
History, 07.04.2021 21:40
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 07.04.2021 21:40
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 07.04.2021 21:40
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 07.04.2021 21:40