subject
Biology, 15.10.2020 03:01 skrillex88

Give an example You will predict the effects of a disruption to the cell cycle and explain your prediction.

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 00:00
Which ideas did your answer contain? check all that apply. no food for organisms no oxygen in the atmosphere no trees or flowering plants no products based on trees or plants (building materials, medicines, fuels, fibers) no fossil fuels
Answers: 3
question
Biology, 22.06.2019 01:30
In a classic experiment using pea shape, mendel conducted two separate genetic crosses. in the first cross the parent plants were “true breeding” for pea shape; one had round peas ( r )and the other had wrinkled (r). the first cross produced a filial 1 generation of all round peas. in the second cross, mendel bred plants from the filial 1 generation. this cross produced different results. out of approximately 1000 plants, about 75% were round and 25% were wrinkled.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:50
Read this summary of a scientific theory: "cells are the most basic structural and functional units of life. all living organisms are made up of one or more cells. all cells that are alive in the world today came from pre-existing cells." which of the following would require this theory to be modified? -a.) a survey finds that a majority of people believe viruses carry out the basic processes of life. -b.) a prominent scientist says she feels strongly that one day the theory will be challenged by life on other planets. -c.) the dna of unicellular and multi-cellular organisms is shown to have many fundamental similarities. -d.) scientific observations show that microscopic organisms living in the deep ocean are not made up of cells.
Answers: 1
You know the right answer?
Give an example You will predict the effects of a disruption to the cell cycle and explain your pred...
Questions
question
Spanish, 22.06.2019 09:30
question
Chemistry, 22.06.2019 09:30
Questions on the website: 13722367