Biology, 12.10.2020 19:01 ahnaodoido384

A student is studying cell structures and organelles. He wants to create an explanation of how the various organelles interact to meet the cell’s need for proteins while preventing too many proteins from collecting inside the cell. Which of the following would be the BEST explanation for the student to use? A.
The ribosomes that cover the rough endoplasmic reticulum manufacture proteins. These proteins are sent to lysosomes where they are modified and sorted based on their destinations. Proteins no longer needed by the cell are broken down by the Golgi apparatus.

B.
The surface of the smooth endoplasmic reticulum manufactures proteins. These proteins are sent to the Golgi apparatus where they are modified and sorted based on their destinations. Proteins no longer needed by the cell are broken down by lysosomes.

C.
The ribosomes that cover the Golgi apparatus manufacture proteins. These proteins are sent to the smooth endoplasmic reticulum where they are modified and sorted based on their destinations. Proteins no longer needed by the cell are broken down by lysosomes.

D.
The ribosomes that cover the rough endoplasmic reticulum manufacture proteins. These proteins are sent to the Golgi apparatus where they are modified and sorted based on their destinations. Proteins no longer needed by the cell are broken down by lysosomes.

Answers: 3

Show answers

Another question on Biology

Biology, 21.06.2019 16:00

Why does the alligator have one of the strongest bite force and why does it run so fast i need to know i live in florida

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

Biology, 22.06.2019 12:30

Is becoming less expensive to screen blood samples for dna certain diseases have genetic basis what is possible ethical concern about the availability of inexpensive dna testing

Answers: 1

Answer

Biology, 22.06.2019 15:30

On his trip to the galapagos islands, darwin determined that animals on the islands

Answers: 1

Answer

You know the right answer?

A student is studying cell structures and organelles. He wants to create an explanation of how the v...

Questions