Answers: 3
Biology, 22.06.2019 02:00
The phylogenetic tree illustrates the relationship between humans and our closest living relatives. the tree was based on biochemical comparisons, including dna and amino acid sequences. according to the biomolecular data, we could infer that a) the four organisms do not have a common ancestor. b) humans are more closely related to chimps than any other apes. c) chimps are more closely related to gorillas than they are to humans. eliminate d) there is no evidence if any relationship between the four branches on the tree.
Answers: 3
Biology, 22.06.2019 10:30
16. which of the following accurately describes a step within transcription? a. dna polymerase uses one strand of rna as a template to put together nucleotides. b. the dna strand is used as a template for which a complementary rna strand can be produced. c. the rna strand forms a template by which dna can be built. d. the rna strand is produced within the cytoplasm.
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:30
Which of the following shows the results that you would get if you tested beef using the four tests in the gizmo
Answers: 1
Which of the following statements about the importance of cell division in unicellular or multicellu...
Chemistry, 16.10.2019 02:50
Computers and Technology, 16.10.2019 02:50
Mathematics, 16.10.2019 02:50
Mathematics, 16.10.2019 02:50
History, 16.10.2019 02:50
Mathematics, 16.10.2019 02:50
Mathematics, 16.10.2019 02:50
Physics, 16.10.2019 02:50
Physics, 16.10.2019 02:50
Chemistry, 16.10.2019 02:50
Mathematics, 16.10.2019 02:50
Mathematics, 16.10.2019 02:50