Answers: 3
Biology, 21.06.2019 15:00
Forces that are equal in strength but opposite in direction are a.) balanced b.) unbalanced c.) always result in motion d.) do not exist
Answers: 2
Biology, 22.06.2019 05:30
Plants consume most of their carbon from a. the soil b. the water c. the roots d. the air
Answers: 2
Biology, 22.06.2019 11:30
According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Experimental investigation definition...
Mathematics, 03.09.2020 20:01
Mathematics, 03.09.2020 20:01
Engineering, 03.09.2020 20:01
Health, 03.09.2020 20:01
Mathematics, 03.09.2020 20:01
Computers and Technology, 03.09.2020 20:01
Spanish, 03.09.2020 20:01
Chemistry, 03.09.2020 20:01
History, 03.09.2020 20:01
Physics, 03.09.2020 20:01
Advanced Placement (AP), 03.09.2020 20:01