Answers: 1
Biology, 21.06.2019 18:10
What is unique about the members of the group of fungi to which penicillium notatum belongs? they are not important for medicine. they are not made up of hyphae. they are used in fermentation. they lost the reproductive phase.
Answers: 2
Biology, 21.06.2019 20:00
Arrange the following in the correct sequence, from earliest to most recent, in which these plant traits originated. 1. sporophyte dominance, gametophyte independence 2. sporophyte dominance, gametophyte dependence 3. gametophyte dominance, sporophyte dependence a) 1 β 2 β 3 b) 2 β 3 β 1 c) 2 β 1 β 3 d) 3 β 2 β 1 e) 3 β 1 β 2
Answers: 1
Biology, 22.06.2019 00:00
Identify the type of energy used in each action. the flexing of an arm muscle: a signal transduction process by a neuron: a ball at the top of a hill: 1. electrical energy 2. mechanical energy 3. gravitational potential energy
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Enjoy a flow chart that explains how Tom's nervous system controls his actions as part of the flowch...
History, 09.07.2019 18:00
Mathematics, 09.07.2019 18:00
Mathematics, 09.07.2019 18:00
Mathematics, 09.07.2019 18:00
Mathematics, 09.07.2019 18:00
Mathematics, 09.07.2019 18:00
Geography, 09.07.2019 18:00
Biology, 09.07.2019 18:00
Mathematics, 09.07.2019 18:00
Geography, 09.07.2019 18:00
Mathematics, 09.07.2019 18:00