Answers: 1
Biology, 21.06.2019 18:00
1. the passing of is the basis of heredity. 2. our encode the instructions that define our traits. 3. each of us has thousands of genes, which are made of and reside in our chromosomes. 4. in addition to our genes, the we live in also define our traits. 5. humans have two complete sets of chromosomes. 6. when parents conceive a child, each parent contributes set of chromosomes. 7. every child receives of its chromosomes from the mother and half from the father. 8. this transfer takes place at when the father’s sperm joins the mother’s egg. 9. while most cells in our bodies have two sets of chromosomes, or a total of egg and sperm each have chromosomes. 10. when egg and sperm unite they create a single cell called a 11. each parent contributes complete set of chromosomes to their child. 12. since the parents contribute the chromosomes to each new child, every child inherits a unique set of chromosomes. 13. as a result, every baby will have a combination of traits.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 16:10
Several bodily responses are described below. for each response, determine what caused the change in homeostasis. body starts to sweat breathing rate increases amount of saliva produced changes body starts to shiver
Answers: 3
Biology, 22.06.2019 20:00
Which of the following statements about genes and traits is true? a single trait can be controlled by multiple genes. a single gene can control a single trait. a single trait can alter multiple genes. a single gene can influence multiple traits.
Answers: 3
What is the symbol for lipids, dna, and protien...
Mathematics, 31.03.2020 02:01
History, 31.03.2020 02:01
Mathematics, 31.03.2020 02:01
Mathematics, 31.03.2020 02:01
Mathematics, 31.03.2020 02:01
Computers and Technology, 31.03.2020 02:01
Mathematics, 31.03.2020 02:01
Mathematics, 31.03.2020 02:01