subject
Biology, 04.10.2020 18:01 kayliebug2003

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

ansver
Answers: 2
Show answers

Another question on Biology

question
Biology, 22.06.2019 06:00
Duchenne muscular dystrophy is a serious condition caused by a recessive allele of a gene on the human x chromosome. the patients have muscles that weaken over time because they have absent or decreased dystrophin, a muscle protein. they rarely live past their twenties. how likely is it for a woman to have this condition? a) women can never have this condition.b) one-fourth of the daughters of an affected man would have this condition.c) one-half of the daughters of an affected father and a carrier mother could have this condition.d) only if a woman is xxx could she have this condition.
Answers: 2
Answer
question
Biology, 22.06.2019 07:50
45 points how are people today being protected from tsunamis? earthquake data is analyzed to detemrine if a tsunami is likely, and if so, warnings are sent out. areas in tsunami risk zones are no longer heavily populated. radar is used to measure wave heights regularly. meteorologists study the winds to determine if wave heights will be large.
Answers: 1
Answer
question
Biology, 22.06.2019 16:40
What is the function of the nucleus in the euglena cells you observed?
Answers: 1
Answer
question
Biology, 22.06.2019 23:00
Before classifying insects into different orders,review the larger classification for insects: • kingdom: animalia • phylum : arthropoda • class : insecta conduct research online to determine the characteristics an organism must have to be classified in each of the taxonomy levels shown. note the characteristics you find in the answer space.
Answers: 3
Answer
You know the right answer?
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...
Questions
question
Chemistry, 24.02.2021 21:50
A simple calorimeter contains 150.0g of water. A 5.20 g piece of an alloy at 525.0 celcius is dropped into the calorimeter causing the water to increa...
question
Mathematics, 24.02.2021 21:50
Solve y 3/2 y equal 9​...
question
Chemistry, 24.02.2021 21:50
Given the following balanced equation, which is NOT a correct conversion factor? 4 NH3 + 5 O2 → 4 NO + 6 H2O Group of answer choices
question
Business, 24.02.2021 21:50
Free brainliest for any dum aà´Ÿà´Ÿ that is a gy d ing mon...
question
Biology, 24.02.2021 21:50
Question 4 In a certain low-elevation environment in New York state, lichens and mosses are the predominant forms of life. This community most...
question
History, 24.02.2021 21:50
Which statement best completes the diagram ...
question
Mathematics, 24.02.2021 21:50
Solve the right triangle shown in the figure. BC=2.7cm, AC=1.1cm, angle C=90 degrees...
question
Physics, 24.02.2021 21:50
PLEASE HELP! AND DO NOT ANSWER IF YOU ARE NOT EDGE PERSON! Absorption and Radiation by Land and Water: What is your hypothesis for this experi...
question
History, 24.02.2021 21:50
Jameson and Quincy each deposit $7,000 into accounts that earn 6% interest, but Jameson earns annual simple interest while Quincy earns annual compou...
question
Mathematics, 24.02.2021 21:50
In ΔLMN, n = 910 inches, ∠L=64° and ∠M=31°. Find the length of l, to the nearest 10th of an inch....
question
Arts, 24.02.2021 21:50
Finish the lyrics: 1. You know I like my chicken fried. Cold beer on a Friday night 2. Come on in boy, sit on down. And tell me 'bout yourself...
question
Mathematics, 24.02.2021 21:50
Terrance has 12 of the 15 collector's edition books in a series. Keymar has 4/5 of the series. Who has more books? Group of answer choices
question
Social Studies, 24.02.2021 21:50
What is the height of burj Khalifa​...
question
Mathematics, 24.02.2021 21:50
Combine Like terms: 3x – 2x + 5 + x pls show work...
question
Chemistry, 24.02.2021 21:50
Using at least 5 sentences, mostly in your own words, describe the nitrogen cycle including the following terms: bacteria, atmosphere, nitrogen, plant...
question
History, 24.02.2021 21:50
How does the United Nations use technology to solve the problems resulting from the language barrier during meetings of the General Assembly?...
question
Mathematics, 24.02.2021 21:50
Find the lengths of DB and EC given the length of FB is 31.66 cm
question
Mathematics, 24.02.2021 21:50
Which is the best estimate of StartRoot 47 EndRoot to the nearest tenth? 6.8 6.9 7.0 7.1...
question
Mathematics, 24.02.2021 21:50
A scalene triangle is rotated 90 clockwise about the origin. Which of the following statements is not true? A. The new triangle is the same size as t...
question
Mathematics, 24.02.2021 21:50
Please help I need it ...
More questions: Biology Another questions
Questions on the website: 13722367
See results (0)