subject
Biology, 21.09.2020 14:01 aidentrooper8629

Think about the relationship between each word pair below. Then write a question about the first term that

uses the second term as the answer. For the pair

organism cell

, the question could be "What is the

basic building block of all organisms?" Answer the cell

4. evolution, adaptation

5. observation data

6. DNA, gene

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 03:20
Mrna decodes information from the original dna master plan to build proteins in the during the process of ribosomes.
Answers: 3
question
Biology, 22.06.2019 08:00
What type of pollution does household garbage cause
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
What type of graph presents information about how often certain or traits occur?
Answers: 1
You know the right answer?
Think about the relationship between each word pair below. Then write a question about the first te...
Questions
question
History, 07.04.2020 22:49
Questions on the website: 13722367