![subject](/tpl/images/cats/biologiya.png)
Biology, 21.09.2020 14:01 aidentrooper8629
Think about the relationship between each word pair
below. Then write a question about the first term that
uses the second term as the answer. For the pair
organism cell
, the question could be "What is the
basic building block of all organisms?" Answer the cell
4. evolution, adaptation
5. observation data
6. DNA, gene
![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:20
Mrna decodes information from the original dna master plan to build proteins in the during the process of ribosomes.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
What type of graph presents information about how often certain or traits occur?
Answers: 1
You know the right answer?
Think about the relationship between each word pair
below. Then write a question about the first te...
Questions
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 07.04.2020 22:49
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 07.04.2020 22:49
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 07.04.2020 22:49
![question](/tpl/images/cats/istoriya.png)
History, 07.04.2020 22:49
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 07.04.2020 22:49
![question](/tpl/images/cats/mat.png)
Mathematics, 07.04.2020 22:49