Scientists have taken genes from a species of bacteria that is pathogenic to several insects and inserted the genes into potato plants. The bacterial genes cause a cell to produce toxins that kill the insects. As the potato plants grow, every cell of the plant contains the toxin-producing genes. This makes the potato resistant to attack by crop pests. Which of the following is a limitation of this new technology? A. There are no foreseen limitations with inserting bacterial genes into crop plants. B. The introduced gene will cause more diversity in the potato's genome, thus causing the potato plant to become extinct. C. The genetically altered potato plants will kill off so many insects that companies that manufacture pesticides will soon go out of business. D. Over time, insects are likely to develop resistance to the bacterial toxin.
Answers: 3
Biology, 22.06.2019 00:10
How does natural selection change thephenotypes within a population over time?
Answers: 1
Biology, 22.06.2019 04:00
Indicate the coat color and the proportion of offspring with that color for each of the following crosses of rabbits. assume all are homozygous. chinchilla x chinchilla 1/2 agouti, 1/2 chinchilla 3/4 agouti, 1/4 chinchilla all chinchilla
Answers: 3
Biology, 22.06.2019 05:30
What is the compliment dna strand to the following sequence: ttgactaggcta
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Scientists have taken genes from a species of bacteria that is pathogenic to several insects and ins...
Mathematics, 06.07.2021 18:30
Mathematics, 06.07.2021 18:30
Mathematics, 06.07.2021 18:30
Mathematics, 06.07.2021 18:30
Mathematics, 06.07.2021 18:30
Mathematics, 06.07.2021 18:30
Mathematics, 06.07.2021 18:30
Mathematics, 06.07.2021 18:30
French, 06.07.2021 18:30
Engineering, 06.07.2021 18:30