Biology, 02.09.2020 14:01 joynerjaila
helppp Frog T has escaped from a pet shop! Luckily, you were able to obtain a DNA sample from the shop. Shown below are Frogs Q, R, and S, and also the DNA scans for Frons Q, R, S, and T. If bands 7-9 control eye color, what is the eye color of Frog T? a Pink b Blue c Organge d Green
Answers: 1
Biology, 22.06.2019 08:00
Acell goes through cellular respiration and produces atp which it then uses to move a molecule across the cell membrane. how does the energy in the original glucose molecule change during this process? (2 points)
Answers: 1
Biology, 22.06.2019 09:30
Which short-term environmental change is most likely to lead to ground shifting, landslides, and the collapse of buildings or roads? forest fires flooding earthquakes
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
helppp Frog T has escaped from a pet shop! Luckily, you were able to obtain a DNA sample from the s...
Mathematics, 01.12.2020 04:40
History, 01.12.2020 04:40
History, 01.12.2020 04:40
Mathematics, 01.12.2020 04:40
Mathematics, 01.12.2020 04:40
Mathematics, 01.12.2020 04:40
Mathematics, 01.12.2020 04:40
History, 01.12.2020 04:40
Mathematics, 01.12.2020 04:40
Mathematics, 01.12.2020 04:40
English, 01.12.2020 04:40
Mathematics, 01.12.2020 04:40
Chemistry, 01.12.2020 04:40
Mathematics, 01.12.2020 04:40