![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 16:30
What does gradualism and punctuated equilibrium have in common
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 01:00
Put the following processes of protein synthesis in the correct order: - dna strands unwind and separate - mrna copies dna according to complimentary base pairing - trna's anticodons bring amino acids to the corresponding mrna codons - amino acids bind to each other making a protein - mrna leaves the nucleus - a stop codon is reached, the newly formed protein is released to go do its job for the cell
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:00
In 1959, doctors began using the powerful antibiotic methicillin to treat infections of staphylococcus aureus, but within two years, methicillin-resistant strains of s. aureus (mrsa) appeared. how did the resistant strains of s. aureus emerge? in 1959, doctors began using the powerful antibiotic methicillin to treat infections of staphylococcus aureus, but within two years, methicillin-resistant strains of s. aureus (mrsa) appeared. how did the resistant strains of s. aureus emerge? staphylococcus aureus bacteria that were able to synthesize cell walls using a protein that was not affected by methicillin survived the methicillin treatments and reproduced at higher rates than did other individuals. over time, these resistant individuals became increasingly common. in response to treatment of staphylococcus aureus infections with methicillin, some bacteria began to synthesize cell walls using a protein that was not affected by methicillin. these bacteria survived the methicillin treatments and reproduced at higher rates than did other individuals. over time, these resistant individuals became increasingly common. in response to treatment of staphylococcus aureus infections with methicillin, bacterial populations gradually began to synthesize cell walls using a protein that was not affected by methicillin.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Can someone answers these for me but also explain what are they asking me , this is due tmr at 11:59...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 10.03.2021 17:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 10.03.2021 17:20
![question](/tpl/images/cats/istoriya.png)
History, 10.03.2021 17:20
![question](/tpl/images/cats/mat.png)
Mathematics, 10.03.2021 17:20
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 10.03.2021 17:20
![question](/tpl/images/cats/mkx.png)
Arts, 10.03.2021 17:30
![question](/tpl/images/cats/mat.png)
Mathematics, 10.03.2021 17:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 10.03.2021 17:30
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/istoriya.png)
History, 10.03.2021 17:30
![question](/tpl/images/cats/mat.png)
Mathematics, 10.03.2021 17:30
![question](/tpl/images/cats/mkx.png)
Arts, 10.03.2021 17:30
![question](/tpl/images/cats/mat.png)
Mathematics, 10.03.2021 17:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 10.03.2021 17:30
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 10.03.2021 17:30