subject
Biology, 26.08.2020 17:01 slmjmlawson

A kitten weighs 3 pounds on earth, how much would the kitten weigh on the moon?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 02:30
Sally and sue were investigating the topic of friction in science. they used a small car and a ramp as seen in the picture to test what they were learning. they knew that they slipped easily on waxed floors but not on carpet, so they decided to change the material on the surface of the ramp to see what happened. they planned to use glass, carpet, aluminum foil, and sandpaper and run the car down the ramp over each surface. what would be the best research question to guide the girls' experiment? a) does the amount of surface area affect the friction on the moving car? b) will the car travel fastest on the glass surface? c) how does the angle of the ramp affect the speed of the car? d)do rougher surfaces tend to create more friction than smooth surfaces?
Answers: 1
question
Biology, 22.06.2019 10:10
Which example describes a mutualistic relationship between organisms? young wasps prey on caterpillars. crabs eat the remains of dead fish. tapeworms feed on food in the intestines of cats ants protect a tree on which they feed.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:20
Suppose a particular species of tulip plant has three alleles for the gene that codes for flower color. the cr allele produces red tulips, the cp allele produces purple tulips, and the cw allele produces white tulips. cr is dominant over cp and cw, and cp is dominant over cw. for each of the following crosses, determine the expected ratio of offspring for each flower color. cr cp x cp cw cr cw x cp cw 1 red: 1 purple : 0 white, 1 red: 2 purple: 1 white, 2 red: 1 purple 1 white, 1 red: 3 purple : 0 white, 2 red: 0 purple : 2 white, 2 red: 2 purple : 0 white
Answers: 2
You know the right answer?
A kitten weighs 3 pounds on earth, how much would the kitten weigh on the moon?...
Questions
question
Mathematics, 22.02.2021 20:50
question
Mathematics, 22.02.2021 20:50
question
Mathematics, 22.02.2021 20:50
question
English, 22.02.2021 20:50
question
Mathematics, 22.02.2021 20:50
question
Mathematics, 22.02.2021 20:50
Questions on the website: 13722367