1. The following sequence was taken from a DNA molecule 5'- AACCTTTAGGGCCCTTTAAA - 3'
Given that the temperature required breaking, one bond in the molecule is 12°C. What is
the total temperature required to completely break the entire DNA molecule.
a 48°C
b. 57.6°C
C. 240°C
d. 480°C
e. 576°C

Which of the following represents the correct format for the scientific name? a. staphylococcus aureusb. staphylococcus aureusc. staphylococcus aureusd. staphylococcus aureus

Which best describes how the common cold spreads in the human body? a bacteria burst out of normal cells killing them b viruses replicate inside respiratory cells c bacteria inject dna into normal cells d viruses insert dna into bacteria

Agroup of students is studying convection currents. they fill two identical balloons with the same amount of helium. one balloon is placed in a freezer and the other in an area with warm air. after 10 minutes, the balloons are released from a height of 1 meter. which of the following do the students most likely observe? question 8 options: the cold balloon expands and rises. the warm balloon shrinks and sinks. the balloons rise at the same rate. both balloons are the same size. the ballons both rise. the cold ballon is larger than the warm balloon. the warm balloon expands and rises. the cold balloon shrinks and sinks.