Answers: 1
Biology, 22.06.2019 05:50
Which of the organisms listed below performs nitrogen fixation? a. legumes b. plants c. bacteria d. fungi
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 19:20
3. in the fruit fly, recessive mutation brown, b, causes brown color of the eye and absence of red pigment. recessive mutation p of another independent gene causes purple color of the eye and absence of brown pigment. the cross of a brown-eyed female and purple-eyed male produced wild type eyes. what will be the colors and their ratio in f2?
Answers: 2
Biology, 22.06.2019 21:30
At the beginning of the virtual lab, you were asked to sort eight lizards into categories. what criteria did you initially use to make your groups? did you revise your criteria later? why?
Answers: 1
a bird runs into the window of a building because it sees its reflection of the sky in the window. t...
Mathematics, 18.01.2021 20:30
Mathematics, 18.01.2021 20:30
History, 18.01.2021 20:30
History, 18.01.2021 20:30
Mathematics, 18.01.2021 20:30
History, 18.01.2021 20:30
English, 18.01.2021 20:30
Biology, 18.01.2021 20:30
Mathematics, 18.01.2021 20:30
Mathematics, 18.01.2021 20:30
Mathematics, 18.01.2021 20:30