subject
Biology, 07.06.2020 21:57 lclaudettecarte3550

As the trait is dominant and controlled by a single gene, the mutation must have occurred on both diploid copies, true or false?? with reason please

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 04:30
This part insulates the reaction chamber from the transfer of heat to or from the surrounding environment
Answers: 1
question
Biology, 22.06.2019 08:30
Both male and female gametes are created during the process of meiosis. the formation of male gametes is called spermatogenesis. after telophase il of spermatogenesis, there would be are all genetically male gametes created that
Answers: 2
question
Biology, 22.06.2019 09:00
What is the significance of the protein-lined pits? a. protein attracts other proteins needed for atp synthesis within the cell. b. protein-lined pits are able to transport one molecule at a time down the concentration gradient within the cell. c. the polarity of proteins allows other polar molecules to attach and be transported in the cell by transport channels. d. receptors within the pits allow ligands to fuse and be transported into the cell by endocytosis.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
As the trait is dominant and controlled by a single gene, the mutation must have occurred on both di...
Questions
question
Chemistry, 01.12.2019 07:31
question
Computers and Technology, 01.12.2019 07:31
Questions on the website: 13722363