Biology, 23.05.2020 02:01 wulfredo67

Using special Amazon scientists have successfully removed the gene that controls the production of interferon and have inserted this gene into The DNA of certain bacteria these bacteria can now produce interim This technique is known

Genetic engineering

Amniocentesis

Cloning

Karyotyping

Stem cell manipulation

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 19:00

Four types of motile cells in human body?

Answers: 1

Answer

Biology, 22.06.2019 03:00

Johnny rode his bike to a friend's house 4 blocks down the street in his neighborhood. he immediately rode back home once he realized his friend was not able to play. what was his displacement for the total bike ride? how did you determine this? what could we use as a reference point to determine he was in motion during his bike ride? why can you use it as a reference point

Answers: 1

Answer

Biology, 22.06.2019 10:00

How do plants obtain more sunlight a.) they lean towards the light b.)they grow straight up c.) they only live in sunny areas, like the tropics d.) they stay low to the ground

Answers: 2

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Using special Amazon scientists have successfully removed the gene that controls the production of i...

Questions