This trophies pyramid shows the different types of organisms in an ecosystem. Why do you think a pyramid shape is used to show this categorization?

1. in a certain species of plant, the color purple (p) is dominant to the color white (p). according the punnett square, what is the probability of and offspring being white? 50%25%0%100% 2. in a certain species of plant, the color purple (p) is dominant to the color white (p). according the punnett square, what is the probability of and offspring being white? 0%100%50%25%(picture 1 is for question 1, and picture 2 is for question 2)

In a population that is in hardy-weinberg equilibrium, there are two possible alleles for a certain gene, a and a. if the frequency of allele a is 0.4, what fraction of the population is heterozygous? a. 0.40 b. 0.60 c. 0.16 d. 0.48

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?