subject

Biology, 05.05.2020 06:33 momo842

The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is read from left to right.

AUUUAACUGUUCUGUCUAGAG

1. Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

2. Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

ansver

Answers: 2

Show answers

Another question on Biology

question

Biology, 22.06.2019 01:30

Which of these best describes what occurs during cytokinesis? a) the chromosomes are separated b) the cell begins to divide by replicating the chromosomes c) the cytoplasm is divided between the two new daughter cells d) the nucleus opens to allow the chromosomes to enter the cytoplasm

Answers: 1

question

Biology, 22.06.2019 09:00

Suppose you could go back in time to interview henri becquerel on the day he discovered radioactivity. from his perspective, write an account of the discovery.

Answers: 2

question

Biology, 22.06.2019 11:30

According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes

Answers: 2

question

Biology, 22.06.2019 19:00

What do genes contain the code for?

Answers: 1

You know the right answer?

The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is...

Questions

question

Social Studies, 19.11.2019 00:31

Which criteria do people in the united states use to determine a person's rank in society? a. age b. race c. occupation...

question

History, 19.11.2019 00:31

What was confucius' method of documenting his teaching?...

question

History, 19.11.2019 00:31

Why was is important that madison kept notes on the constitutional convention?...

question

Chemistry, 19.11.2019 00:31

Try moving an electron from the metal to the nonmetal. what happens?...

question

Health, 19.11.2019 00:31

What are some exercises to do at home? i need a few, i cant think of many lol brainliest to whoever can give me plenty: )...

question

Business, 19.11.2019 00:31

Suppose that initially, the economy is in long-run macroeconomic equilibrium at point a. if there is increased pessimism about the future of the econo...

question

Physics, 19.11.2019 00:31

Acrane winch is lifting a 2300-kg mass. the winch can be modeled as a cable of negligible mass wound around a solid uniform cylinder with a 12-cm radi...

question

Physics, 19.11.2019 00:31

Aball whose mass is 0.4 kg hits the floor with a speed of 4 m/s and rebounds upward with a speed of 1 m/s. if the ball was in contact with the floor f...

question

Business, 19.11.2019 00:31

Llars) (diamonds) 8,000 5,000 7,000 6,000 6,000 7,000 5,000 8,000 4,000 9,000 3,000 10,000 2,000 11,000 1,000 12,000 if there were many suppliers of d...

question

Biology, 19.11.2019 00:31

Select the correct location on the image. a weather map shows contrasting systems of low pressure and high pressure zones. choose the arrow that...

question

Engineering, 19.11.2019 00:31

Consider a ct lti system with frequency response h(j! ) = sin 4! ! (a) if the input to this system is a periodic signal x(t) = 8< : 1 0 t <...

question

Engineering, 19.11.2019 00:31

At steady state, steam with a mass flow rate of 5 kg/s enters a turbine at 400o c and 40 bar and expands to 3 bar. the power developed by the turbine...

question

Business, 19.11.2019 00:31

1. starbucks has become a phenomenon worldwide, with more than 24,000 stores in more than 60 countries. sales are great even at relatively high prices...

question

Business, 19.11.2019 00:31

The charade corporation is preparing its manufacturing overhead budget for the fourth quarter of the year. the budgeted variable manufacturing overhea...

question

Business, 19.11.2019 00:31

Angelina's made two announcements concerning its common stock today. first, the company announced that its next annual dividend has been set at $2.16...

question

Mathematics, 19.11.2019 00:31

Persons having raynaud's syndrome are apt to suffer a sudden impairment of blood circulation in fingers and toes. in an experiment to study the extent...

question

Chemistry, 19.11.2019 00:31

For the following wavelengths, provide the frequency, color, and energy of the light. wavelength (nm) frequency (hz) color energy (j)

question

Physics, 19.11.2019 00:31

The magnitude of the tidal force between the international space station (iss) and a nearby astronaut on a spacewalk is approximately 2gmm...

question

Business, 19.11.2019 00:31

Gonzales corporation generated free cash flow of $ 85 million this year. for the next two years, the company's free cash flow is expected to grow at a...

question

Business, 19.11.2019 00:31

Program in cwrite a program that a daycare center manage their waiting list. the program stores requests for being added to the waiting list. each re...

More questions: Biology Another questions

Questions on the website: 13722361