Biology, 06.05.2020 06:17 christian2510
If the plant populations decrease due to large moose populations, what will ultimately happened to the wolf populations?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:00
How do temperature and salinity affect deepwater currents? question 15 options: as temperatures and salinity levels of water increase, the water rises to the surface where it creates currents as it moves to colder regions. they create changes in wind direction, moving denser water in the same direction as the wind and causing the deepwater circulation patterns found in the ocean. they equalize the forces on undersea currents caused by the coriolis effect as they replace more dense water with less dense water. they create density differences that cause dense deepwater currents to flow toward the equator where they displace less dense, warmer water above them.
Answers: 2
Biology, 22.06.2019 20:50
Assume that you are interested in separating short (200-400 bp) dna molecules from a pool of longer molecules in the 10,000-20,000 nucleotide range. you have two recipes for making your polyacrylamide gels: one recipe uses 1.5 percent agarose and would be considered a “hard gel,” while the other uses 0.5 percent agarose and would be considered a loose gel. which gel should you use to separate the short (200-400 bp) dna molecules from a pool of longer molecules in the 10,000-20,000 nucleotide range?
Answers: 3
Biology, 22.06.2019 23:30
These are groups of reproducing populations that are insulated from other groups
Answers: 1
If the plant populations decrease due to large moose populations, what will ultimately happened to t...
Mathematics, 17.09.2019 11:10
English, 17.09.2019 11:10
History, 17.09.2019 11:10
Social Studies, 17.09.2019 11:10