subject
Biology, 21.04.2020 22:13 montanolumpuy

Which of the following is characteristic of antibodies? Group of answer choices composed of heavy and light polypeptide chains three binding sites per antibody monomer incapable of being transferred from one person to another carbohydrate structure

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 17:30
Which of the following systems in absorbing oxygen and releases carbon dioxide
Answers: 1
question
Biology, 21.06.2019 17:40
What links the two strands in a dna helix together in the middle? a. phosphate groups b. sugar rings bonded together c. proteins d. bases with hydrogen bonds
Answers: 1
question
Biology, 21.06.2019 20:50
Next pretest: evolution select the correct answer in a laboratory population of flies, the female flies are gray and the males are yellowish gray. biologists observed that all the male flies had an equal chance for reproduction, but the male flies with the brightest colors were more likely to successfully reproduce. what phenomenon could explain such a change? a sexual selection b. disruptive selection c. stabilizing selection d. directional selection
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which of the following is characteristic of antibodies? Group of answer choices composed of heavy an...
Questions
question
Mathematics, 19.06.2020 13:57
Questions on the website: 13722367