Question 1.
A-Attached earlobes

a-Unattached earlobes

If A is the allele for having attached earlobes, what percentage of offspring will have attached earlobes?

A. 25%

B. 50%

C. 75%

D. 100%

Question 2.
What genotype would BOTH parents have to be to ensure that ALL offspring have unattached earlobes?

A= Attached

a= Unattached

A. homozygous dominant

B. heterozygous

C. homozygous recessive

What type of electromagnetic wave are microwaves and radar

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Recombinant dna is the merging of dna from unrelated organisms to create new genetic varieties is assembled in the lab from mononucleotides was part of the green revolution of the 1960s is pollination of one plant by another of the same species is cross-pollination of one plant by a different species