![subject](/tpl/images/cats/biologiya.png)
Biology, 15.04.2020 03:05 jadenriley8129
Under which of the following conditions would photosynthesis be favored over photorespiration? A) a high concentration of O₂ within the spongy mesophyll of a plant’s leaves B) a sunny and windy day in an arid environment C) a high concentration of CO₂ within the spongy mesophyll of a plant’s leaves D) the majority of stomata on a plant’s leaves are closed
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:20
Which box will not accelerate? 4 newtons 4 newtons 4 newtons 25 kg 4 newtons 15 newtons 10 kg 30 newtons 40 newtons 50 kg 30 newtons 30 newtons
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:50
The structure of a dna molecule is best described as a. one long strand of nucleic acids b. two strands of dna nucleotides joined by hydrogen bonds c. two strands of amino acids joined by hydrogen bonds d. one long strand of amino acids
Answers: 1
You know the right answer?
Under which of the following conditions would photosynthesis be favored over photorespiration? A) a...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/en.png)
English, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 16.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 16.09.2020 01:01