Biology, 14.04.2020 23:48 Tyrant4life
Identify a hypothetical sequence of bases that might be found in the first 20 nucleotides of a promoter of a bacterial gene (in the nontemplate strand). The start site for transcription will be underlined, and a potential consensus sequence, if one exists, will be in italics. a. 5′–GGACTATATGATGCGGCCCAT–3′b. 5′–GGACTATATGATGCGGCCCAT–3′c. 5′–GGACTATATGATGCGGCCCAT–3′d. 5′–GGACTATATGATGCGGCCCAT–3′
Answers: 1
Biology, 22.06.2019 12:30
Gram-negative bacteria have a cell wall that is! and does not accept the stain, making itappear
Answers: 2
Biology, 22.06.2019 13:00
Which of the following cell structures is significantly different between gram- positive and gram-negative bacteria?
Answers: 3
Biology, 22.06.2019 15:10
Abacteriophage typically attaches to the bacterium and then
Answers: 1
Biology, 22.06.2019 16:30
The offspring of a black cat and a white cat is a gray cat, it has the genotype bw if a black cat mates with a gray cat the chance that the offspring is white will be what percent?
Answers: 1
Identify a hypothetical sequence of bases that might be found in the first 20 nucleotides of a promo...
Biology, 08.10.2019 06:10
Physics, 08.10.2019 06:10
Mathematics, 08.10.2019 06:10
History, 08.10.2019 06:10
Mathematics, 08.10.2019 06:10
History, 08.10.2019 06:10
Mathematics, 08.10.2019 06:10
Business, 08.10.2019 06:10
Mathematics, 08.10.2019 06:10
Mathematics, 08.10.2019 06:10
Biology, 08.10.2019 06:10
Mathematics, 08.10.2019 06:10
Mathematics, 08.10.2019 06:10
History, 08.10.2019 06:10