The middle of an mRNA molecule contains the nucleotide
sequence shown here. Much more of the m...
Biology, 14.04.2020 22:14 lovwhydontwe
The middle of an mRNA molecule contains the nucleotide
sequence shown here. Much more of the mRNA is translated.
Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
Construct an Explanation Based only on the information provided, why could the mRNA
section be translated into three different sets of amino acids, instead of just one set?
Answers: 1
Another question on Biology
Biology, 21.06.2019 18:40
In dna, only the_ varies from one nucleotide to another. base phosphate sugar amino acid
Answers: 2
Biology, 21.06.2019 19:10
Liquid water turns into water vapor at which step in the water cycle
Answers: 2
Biology, 22.06.2019 01:00
What can be said about farmers in highly developed countries? a) they have little or no negative impact on the environment. b) they practice subsistence agriculture. c) they are able to incorporate polyculture into their farming practices. d) they utilize organic farming techniques on a regular basis. e) they rely on large amounts of energy from fossil fuels.
Answers: 3
You know the right answer?
Questions
Mathematics, 12.03.2021 23:00
Social Studies, 12.03.2021 23:00
Social Studies, 12.03.2021 23:00
Chemistry, 12.03.2021 23:00
Social Studies, 12.03.2021 23:00
Mathematics, 12.03.2021 23:00
Mathematics, 12.03.2021 23:00
Mathematics, 12.03.2021 23:00
Physics, 12.03.2021 23:00
Mathematics, 12.03.2021 23:00
Social Studies, 12.03.2021 23:00
