Identify the choice that best completes the statement or answers the question. Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?a. Calculate the frequencies of each letter.
b. Count the number of letters in the list.
c. Separate the list into three-letter "words."
d. Separate the list into two-, three- and four-letter "words."

"1. it should be, it has been for about 20 years, and it's really not much different in the end than breeding animals to have particular traits. there are always concerns about genetically engineered animals/plants affecting the environment in unexpected negative ways, but i can't think of an example where the fears didn't turn out to be baseless.  

first, as you point out, it would be a great advance in pharmacology, to be able to tailor drugs and their doses to me. the pros involve better medical treatment. the cons involve privacy issues like insurance companies denying coverage to people with genetic risk factors. looking at dna markers wouldn't affect the frequency of genetic diseases, but it would allow detection of them earlier. and ok, actually i suppose that if people used this information to avoid having children with genetic diseases, some might decrease in frequency."

lesson summarykaryotypes a genome is the full set of all the genetic information that an organism carries in its dna. chromosomes arebundles of dna and protein found in the nucleus of a eukaryotic cell.