subject
Biology, 09.04.2020 22:12 anglacx5465

What is the correct order of levels of organization, from smallest to largest?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
If a checkpoint detects damaged dna, the checkpoint may
Answers: 1
question
Biology, 22.06.2019 18:00
Which of the following can be assumed about the layers in areas 2 and 4
Answers: 1
question
Biology, 22.06.2019 22:30
What is the role of rna polymerase? it creates the dna strand its the dna strand. it transcribe the dna strand il translates the dna strand save and exit next sube mark this and retum
Answers: 3
You know the right answer?
What is the correct order of levels of organization, from smallest to largest?...
Questions
Questions on the website: 13722367