![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:00
20 points and brainlist 1. london has suffered from terrible air pollution for at least seven centuries. why is the city so prone to its famous βlondon fog? β what did london do to get rid of its air pollution? 2. why does air pollution cause problems in developing nations more than in developed ones?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:00
14) whenever diploid populations are in hardy-weinberg equilibrium at a particular locus a) the allele's frequency should not change from one generation to the next, but its representation in homozygous and heterozygous genotypes may change. b) natural selection, gene flow, and genetic drift are acting equally to change an allele's frequency. c) this means that, at this locus, two alleles are present in equal proportions. d) the population itself is not evolving, but individuals within the population may be evolving.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 16:00
In an hydrogen ion pump the energy is used to join small molecules together to make larger ones which factor most likely has the greatest effect on the number of molecules mitochondria can produce
Answers: 2
You know the right answer?
What crop was produced more than any other in georgia during the reconstruction era?...
Questions
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 20.01.2022 14:00
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 20.01.2022 14:00
![question](/tpl/images/cats/biologiya.png)
Biology, 20.01.2022 14:00
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 20.01.2022 14:00
![question](/tpl/images/cats/mat.png)
Mathematics, 20.01.2022 14:00
![question](/tpl/images/cats/User.png)
![question](/tpl/images/cats/istoriya.png)
History, 20.01.2022 14:00
![question](/tpl/images/cats/mat.png)
Mathematics, 20.01.2022 14:00
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 20.01.2022 14:00
![question](/tpl/images/cats/mat.png)
Mathematics, 20.01.2022 14:00
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)