subject

Biology, 07.04.2020 20:23 makayla7635

Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

ansver

Answers: 3

Show answers

Another question on Biology

question

Biology, 21.06.2019 23:10

Drag the correct tiles to the image. not all tiles will be used. the diagram is a schematic representation of the electron transport mechanism in mitochondria. label the diagram to complete the model.

Answers: 3

question

Biology, 22.06.2019 00:00

Question 1 of 102 pointswhich best describes adaptive radiation? oa. geographical isolation caused by an adaptationob. biodiversity resulting from few ancestorsoc. a decrease in the rate of speciationd. adaptations that organisms teach each other

Answers: 2

question

Biology, 22.06.2019 01:00

Why would a drug the damages capsids treat a viral infection

Answers: 1

question

Biology, 22.06.2019 09:00

What happens when water’s salinity increases? mass decreases. freezing point decreases. buoyancy of objects decreases. the amount of dissolved minerals decreases.

Answers: 2

You know the right answer?

Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG...

Questions

question

Business, 28.10.2020 16:30

Tasty Subs acquired a delivery truck on October 1, 2021, for $25,600. The company estimates a residual value of $1,600 and a six-year service life. Re...

question

Mathematics, 28.10.2020 16:30

Tomas is making trail mix using granola and walnuts. He can spend a total of $12 on the ingredients. He buys 3 pounds of granola that costs $2.00 per...

question

Business, 28.10.2020 16:30

In its first year of operations, Oriole Company recognized $30,000 in service revenue, $8,000 of which was on account and still outstanding at year-en...

question

Social Studies, 28.10.2020 16:30

A battery in torts is any word or action intended to make another person fearful of immediate physical harm, which is a reasonably believable threat:...

question

Business, 28.10.2020 16:30

A 15-year annuity pays $2,200 per month, and payments are made at the end of each month. If the interest rate is 10 percent compounded monthly for the...

question

Mathematics, 28.10.2020 16:30

For lines is parallel. Compare the slopes of the lines for y f(x) and y g(x) to determine if each pair of lines is par SEE EX...

question

Physics, 28.10.2020 16:30

Establishing a potential difference The deflection plates in an oscilloscope are 10 cm by 2 cm with a gap distance of 1 mm. A 100 volt potential diffe...

question

Mathematics, 28.10.2020 16:30

What is the measure of angle QRS in this figure? Q 9x 13x P 20x + 12 R S

question

Mathematics, 28.10.2020 16:30

melvin and roberto played football on two different teams last season . Melvins team won w games . roberto's team won 3 fewer games than melvins team...

question

History, 28.10.2020 16:30

Please help me very fast, ill give brailest whoever helps me FIRST!!! Suppose Congress tried to create new laws that violate the Constitution. Could...

question

Mathematics, 28.10.2020 16:30

PLEASE HELP QUICK!! Steve's bill at a restaurant for lunch was $15. He had exceptional service and wanted to leave a 20% tip for his waiter. What is...

question

Mathematics, 28.10.2020 16:30

Rectangle RSFT has vertices R(3,10), S(5,10), F(5,6) and T(3,6). RSFT was reflected over the line y = x, to form R'S'F'T'. What are the coordinates o...

question

Business, 28.10.2020 16:30

In the competitive forces model, the central element that the other four elements contribute directly to strength is: a. risk of entry by a potential...

question

Physics, 28.10.2020 16:30

Inez is making a model of a sugar crystal. She wants her model to show how the sugar molecules move in the crystal. She is using plastic foams balls t...

question

Biology, 28.10.2020 16:30

Llenar el crucigrama anterior usando las siguientes pistas: HORIZONTALES 2. Lo que sucede con el ADN y el material genético en la Interfase. 5. Etapa...

question

Mathematics, 28.10.2020 16:30

In a survey in 2010, the population of two plant species were found to be growing exponentially. Their growth is given by these equations: species A,...

question

Computers and Technology, 28.10.2020 16:30

In a computer instant messaging survey, respondents were asked to choose the most fun way to flirt, and it found that P(D)equals0.660, where D is dire...

question

Mathematics, 28.10.2020 16:30

Linest and mare perpendicular with point of intersection P. Noah says that a 180 degree rotation, with center P, has the same...

question

Mathematics, 28.10.2020 16:30

20x3y2 – 60x5yz4 Factory the equation...

question

Business, 28.10.2020 16:30

Identify which account would be debited and credited to record each transaction occurred at Forever Green Lawn Service. The first transaction has been...

More questions: Biology Another questions

Questions on the website: 13722361