subject
Biology, 04.04.2020 22:28 nerdykitty4586

Even though opinions vary widely, the kingdom Protista is understood to consist of three general groups. Use your textbook (pg. 401–409) and the web sites below to create a concept map overview of the Protist kingdom. The following terms should be included in your concept map:

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 17:50
How did the research presented in the article affect scientists' understanding of the evolution of eukaryotes
Answers: 3
question
Biology, 21.06.2019 23:30
What is the number of phosphates in an atp molecule
Answers: 1
question
Biology, 22.06.2019 09:00
Which of these is not a nucleotide base found in dna?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Even though opinions vary widely, the kingdom Protista is understood to consist of three general gro...
Questions
question
Mathematics, 22.07.2019 21:00
question
Mathematics, 22.07.2019 21:00
question
Mathematics, 22.07.2019 21:00
question
Mathematics, 22.07.2019 21:00
Questions on the website: 13722367