How do the Linnaean scientific names compare to the names developed by John Ray?
A) Linnaean names are in English.
B) Linnaean names tend to be shorter.
C) Linnaean names tend to be longer.
D) Linnaean names are more specific.

Ras is a g-protein that is activated when a growth factor attaches to egfr. its activation results in the replacement of a gdp molecule with a gtp molecule, thus allowing a signal transduction pathway to be activated. considering the signal pathway illustrated on this page, what is one potential outcome of a mutation in the ras gene that leads to ras protein hyperactivity. be specific.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Explain how the parts of the peripheral nervous system work with the central nervous system to produce a response to the stimulus