Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?
a. Normal gene: ATGGCCGGCCCGAAAGAGACC
b. Mutated gene: ATGGCCGGCACCGAAAGAGACC
c. Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
d. Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
Answers: 1
Biology, 22.06.2019 05:30
To maintain asepsis when administering an injection, all parts of the syringe can be handled except the:
Answers: 3
Biology, 22.06.2019 09:30
What type of plant is good for a bioassay and where can i buy it? i only have a month.
Answers: 2
Biology, 22.06.2019 11:00
Many organizations release indexes used to measure the development of the world's countries. as we learned in this lesson, these indexes measure many factors, from life expectancy to happiness. in your opinion, what are the three most important factors we can use to determine how developed a country might be? explain your answers in a few sentences.
Answers: 1
Biology, 22.06.2019 12:00
Matched chromosomes carrying information about the same characteristics in the organism are called
Answers: 1
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is...
Mathematics, 20.10.2020 07:01
Mathematics, 20.10.2020 07:01
Mathematics, 20.10.2020 07:01
Social Studies, 20.10.2020 07:01
History, 20.10.2020 07:01
Mathematics, 20.10.2020 07:01
Mathematics, 20.10.2020 07:01
Mathematics, 20.10.2020 07:01
English, 20.10.2020 07:01
Mathematics, 20.10.2020 07:01