subject
Biology, 25.03.2020 05:48 yah2muchh

: Which two of the following features are determined by the length of a gene and its particular sequence of As, Cs, Gs and Ts?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 18:30
When does dna replication(make a copy of itself)?
Answers: 1
question
Biology, 22.06.2019 04:30
Anton created a chart listing different types of materials. which best complete the chart?
Answers: 3
question
Biology, 22.06.2019 05:30
β€œin 1492 columbus sailed the ocean blue” is an example of: a)explicit memory b) procedural memory c) semantic memory d)episodic memory
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
: Which two of the following features are determined by the length of a gene and its particular sequ...
Questions
question
Computers and Technology, 13.10.2020 14:01
question
Mathematics, 13.10.2020 14:01
question
Physics, 13.10.2020 14:01
Questions on the website: 13722367