Biology, 20.03.2020 21:50 xelynncaldera
Describe how the nervous and muscular systems interact to maintain homeostasis when a person's body temp drops
Answers: 3
Biology, 22.06.2019 02:00
Bisphenol a (often called bpa) is a chemical found in products that people use every day, from water bottles to food containers to children's toys. unfortunately, bpa leaches out of its many products and makes its way into our bodies. what are the health effects of bpa exposure? ongoing research is finding that elevated exposure to bpa can affect a wide variety of developmental and physiological processes, but one of the first studies of bpa's health effects came about because of a simple mistake in the lab. at a laboratory at case western reserve university in 1998, geneticist patricia hunt was making a routine check of her female lab mice. as she extracted and examined developing eggs from the ovaries, she began to wonder what had gone wrong. she noticed that many of the eggs showed problems with their chromosomes, and some had irregular amounts of genetic material, which can lead to miscarriages and birth defects in mammals. she learned that a lab assistant had mistakenly washed the plastic mouse cages and water bottles with a harsh soap, releasing bpa from the plastic. knowing that bpa is an endocrine disruptor, a chemical that can enter organisms and mimic hormones, hunt set out to discover whether it had adversely affected her mice.
Answers: 2
Biology, 22.06.2019 09:00
Describe the relationship and movement between temperature and density in a convection cell. make sure you identify the direction of travel
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
In trying to determine whether dna or protein is the genetic material, hershey and chase made use of which of the following facts? a) dna contains sulfur, whereas protein does not. b) dna contains phosphorus, whereas protein does not. c) dna contains nitrogen, whereas protein does not. d) dna contains purines, whereas protein includes pyrimidines.
Answers: 3
Describe how the nervous and muscular systems interact to maintain homeostasis when a person's body...
Physics, 30.06.2019 19:00
Social Studies, 30.06.2019 19:00
Social Studies, 30.06.2019 19:00
Biology, 30.06.2019 19:00
History, 30.06.2019 19:00
Health, 30.06.2019 19:00
Mathematics, 30.06.2019 19:00
English, 30.06.2019 19:00
Physics, 30.06.2019 19:00