Biology, 03.03.2020 02:03 Happygirl5715
What is nutrient pollution, and how does it get into the ocean? Where does it come from?
Answers: 3
Biology, 21.06.2019 22:40
Environmental differences within ecosystems are generally caused by
Answers: 1
Biology, 22.06.2019 08:00
Aparent with freckles is crossed with a parent without freckles. the punnett square shows the possible genotypes and phenotypes of the offspring. which statement accurately describes the probability of phenotypes? a.the offspring are more likely to have freckles. b.the offspring are more likely to have no freckles. c.the likelihood of the offspring having freckles and not having freckles is the same. d.the likelihood of the offspring having freckles and not having freckles cannot be determined.
Answers: 1
Biology, 22.06.2019 11:50
Which of the following describes how binary fission and mitosis are similar? a)they are both used for growth or repair b)they both break down membrane-bound nuclei c)both invoke the replication of a single stand of dna d)both replicate genetic material
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
What is nutrient pollution, and how does it get into the ocean? Where does it come from?...
Mathematics, 27.05.2021 17:00
Social Studies, 27.05.2021 17:00
Mathematics, 27.05.2021 17:00
Mathematics, 27.05.2021 17:00
Mathematics, 27.05.2021 17:00
Mathematics, 27.05.2021 17:00
Mathematics, 27.05.2021 17:00
Mathematics, 27.05.2021 17:00
Mathematics, 27.05.2021 17:00
Physics, 27.05.2021 17:00
Biology, 27.05.2021 17:00
Mathematics, 27.05.2021 17:00
Mathematics, 27.05.2021 17:00
Geography, 27.05.2021 17:00